EST 406176 is a singleton


Sequence

>406176 (1 EST) Length=341 GCACGTCTGAGTCGTTGTCTACACAGATCTCGTTTGGGTGGGAGATGGCAGATGCCGTCGAGCATTTACTTGTCACCATC ATCAGTACATCTCAACAGTCACCGGGTCGAGNAGTTGCATAAGCCAATTCGCANGNGTATNAATTNTGTGTCTGCACAAT CGCAAGTCCGAAGGTGCTGTGCATCAATCAAGGACTCGTNGGACCGACATCNTTCACAACTCGTAAATGATATTNCAGGA TGGATTATTTCCAGGACAGGGCGCTTCTCCGACGAGGATTGCCAGNAGCACATAGNATATATGGAGTTGGCCTTGCGCTC AGCACAGTGGCCACTATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061761118182H97297SW3ICA466SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:52:0 on Wed 22 Nov 117.