EST 407176 is a singleton


Sequence

>407176 (1 EST) Length=383 AATNCGGAACGAGTCTTGGTGGGATTACGGNTATCAGATTACTGCTATTGNTAATCGTACTGTGCTTGTGGACAATAATA CATGGAATAATACTCATATTGGTCGGGTGGGTCAAGCTATGGCATCANCTGAAGAGGAAGCTTATGAAATTATGAAAGAA TTAGATGTTGATTATGTCCTGGNTATTNTCGGTGGTGTNCTGGGGTACAGNTCTGATGATATCAATAAATTTATTTGGAT GGTACGTNTNGCTGGTAGTACAGAAAAAGGTCGTCATGTACATNAAAAATGATTATTATTCACCACATGGCGAAATGCGT CTAGATGATAGAGCTAGTNTCTCCAATGCAAAACNGTTTATTGTCNCAAAACTTAGGTTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 407176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4071761119182H98297SMNHADA016036T3SmAW


Date: 22:38:41 on Tue 21 Nov 117.