EST 412358 is a singleton


Sequence

>412358 (1 EST) Length=450 GNGTGGNNGACGAGTAAGCGAAATGAGCATTTTATTAATTTTNAGTTGCGGCGGGGTGTATGCATAATAATACTTTNATG ATAACTACTTGCATTTATTGTACTGAAAAGCCACTATAATAACCGGTCGATATCACTAAATGATAAAGTGATAATGNCTA ATGATCTCACCAGGTGATAAAATGATAATGGCTAATGANNTCACCAAATGATAAANTGATAATGANCATTGGTNTGGCAA TTACAAAACTAATTATTGCCGGGTGGGGGGTCGAATTCCATTTCATCAGCANTTATNNAACAACAAAAANTCAATGCANC TTAACAACATTTCTACAGGGCAGGCCATCTAAGCAATTGTGATTGTGCCGGCCTGANACTATCCTTCTAAAAGTGAGACG GNGTCAAGCCAATCGATGCATCGGTGGTTGGCACTTGAAGGAATAAGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 412358: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4123581122538H98316SW3ICA540SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 13:46:14 on Thu 23 Nov 117.