EST 412364 is a singleton


Sequence

>412364 (1 EST) Length=235 TCAAAATGCAAATTCTTTCTACTAATGATATCAAGATCTACAATTTAAGCGCAGGCAAGTCAGCCCCAGAGTGGATTACA GATCGAAAAAGGCGAAAACTGGAACAAAATGATATAGATNGGNGGGGAAGGNTACAACTGATACAAGGGGNGGNCANGCC CNACATCAGCANTACTGGCACGGCCTCTCCTGANGGACGCTATATGTCCGCGACGGGCACGACGANCCAANCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 412364: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4123641122544H98322SW3ICA547SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 7:34:31 on Sat 18 Nov 117.