EST 412370 is a singleton


Sequence

>412370 (1 EST) Length=380 GTGAAATTAAGAAAAAGAAGATCCAATTAGTAGTGCNAATGAATATATGAATAAAGAGGAGATTTGCTGAAGAGACNGGA TATGTCGATCCATCGACTACCAAGCATAAAAAATCCTCAGGAATTAATCGATGATTACTTTACCACTGGTGAACAAGTTT ACAAGTTCGACAGTATTATCGATCAGTTCGAGGGACGTTTTGTGCATTTATCATTGAGTCACAATGGTTTACTGTTATTC TGGAAACAATATAAGGCTAATGAAGTGGTCGGCTCGGAATTCTTGTTATATCGATGATATCATTGATGTATTTTCTTGGC TGTNGTGCGGAACATTCAANGACGACAAAGGGATCCATCAAAAANTTAGATGGGTTACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 412370: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4123701122550H98328SW3ICA554SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:5:27 on Wed 22 Nov 117.