EST 412376 is a singleton


Sequence

>412376 (1 EST) Length=239 AAGAAAAAATTATCCTANTATTAATTTACNAAAGTACANANANAAAGGGAAAAATAAAATGAAAATATTGNTAATGAGAA TTAAATTGTNGATAAATTGTTGATAAAATTATTATTAATATACAAAATATTTAATATATTGCCAGACTTATATTTATTTT ATCATTGATTAAACTTTGTTCTTTCCTNTATAATTCTAAACTGTAATAATGAATTGATTAGTTTGTATTAAATTTGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 412376: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4123761122556H98334SW3ICA560SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 19:30:25 on Sun 19 Nov 117.