EST 415644 is a singleton


Sequence

>415644 (1 EST) Length=263 GGGTGGAATTCATTTTGGACACTGATGTGGNTATCTACGTATTCAGGTTGGAAAGACTTGAACTCAACAAATATCACTTT ATCTAACGTTGAATCTCCAGTTATTTTATTAACTCTAACGAAATTCGATTGANTATGTATTTCCAGTGGGAACATNATAG GAATATTTATTTACGACGAGTCCTCAAAACGTGGTNCCNTGGTTCTCTGAATATACAGCCATATTTCAGNGTCCAATGTG TCAAGAAAGNTCGTTATGNTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415644: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156441122587H98366SMNHADA015016T3SmAW


Date: 3:56:58 on Sat 18 Nov 117.