EST 415649 is a singleton


Sequence

>415649 (1 EST) Length=221 TTGTTTTTAATGGGTTAGGGTCATGTTGGCTGCCTGTGCTTTCAGGTTTGAATATCTCGGNANTAAAGATGANCTCTCAG ACGGATGATACAAAAGTTCATTACGGTCATGGGAGAAGACCTAAAAAACAACGTTGGATTTTAAAAGGAACATTTATATC ANTCTTGCNCCTAANCATGGTAGGGGGAGTGTCCATAANATAANCTCCAGANTTTGNCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 415649: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156491122592H98371SMNHADA015028T3SmAW


Date: 21:42:26 on Mon 20 Nov 117.