EST 415673 is a singleton


Sequence

>415673 (1 EST) Length=379 AATTCGGAACGAGAAGNAAACGGAAAATNCGTATNCACAACAGAAGACTTGGATCTATTGGAGGTGTGCTTCGAAAGTCA GCCAGATAATACTGATACAGAGCAAGAAGTCTTTCTTAATNTCAAACACGGNACGGAGGCCAAGGNTTTGGNTAAGATGG CGAAAGCAGAGNAAATTACAACCAATCGANGTGCTACTGAAAAAAACTTGAAAGTCTAGCTGATGAAATCGTGCAAGATT TCGTNCTCATGCATTCAAAAAGTAGCAAAATGCGAAACATCAATGAATCTACTCACACAAGGGTCCTCTACTTTTTCAAT CCTTNCAATGGTNATCCTCATCGGTTTCGCATTTTGGGCAGGTCCNTTTATTTAAGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 415673: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156731122616H98395SMNHADA015078T3SmAW


Date: 5:59:59 on Wed 22 Nov 117.