EST 415690 is a singleton


Sequence

>415690 (1 EST) Length=261 AATCCGGAACGAGGNAAAGATGTTCATGTTGAGCGTGACAAGTCAACCATACATGTTACCGTTAACATCCCTTTCTCAAA AAGGTNTCTTAANTACCTGACAAAGGAAATTCCTCAAGCGCCACAAACTGCGGGATTTCCTTCGTGTTGTNGCGAAATCA AAGGACTCTTATGAATTTCGGTTCTTCANCTTNGGAAAATGAAGATACGGATGATGAAGAGGAGAATTAATCGNTATGTG TAATAAATGTATAAATGCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 415690: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156901122633H98412SMNHADA016064T3SmAW


Date: 13:36:9 on Thu 23 Nov 117.