EST 415692 is a singleton


Sequence

>415692 (1 EST) Length=344 AATCCGGNACGAGGTGNAAGTTGGTTTTAATTTCCTGAATAATCCATTCTAGCATATCCATATAACTGACAATTATAATT TGGAGTCATTCTCCTATAGATTTCATATATATATTATCCCTTATCATTTATGAACTTACTTTCGATCTCTTNCATATCAA GTTTGNCTTTGTTGATTTCTTATTTNNAATTGGTAATTTTAAACAAAGATGAATATACATATATATGTATTGGGTGGATA AATGATATTGATGATNTCTTCNNATTTATGANTTANCCAACATTAAACTGACAGTTGGGTTACTGGATGCAATACANAAT ATNTGCAAGTAATGGNNTCCTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 415692: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156921122635H98414SMNHADA016068T3SmAW


Date: 12:41:12 on Sun 19 Nov 117.