EST 415696 is a singleton


Sequence

>415696 (1 EST) Length=385 AATTCGGAACGAGCTTCGACCAGCCACGGGGNATCGTGGTGNAAGNAATGTTGGAAAATCTATGGTGCGANTTCTGGATA TCAATGNACTTGNACCATACATAACCGACACGTNGTATCAAATACAATACCAGATTCCAGGTGAGTCTGTCCCANTTTCG GTTGTTANTCCTAATACTAATGAGTGTATNCTAGATAATACAGAGGACTACATCCAACACACCGTCGGACAGATGTAAGA TGAACTTAANNAAGAGGACGAACAATCGATTACAGGACACTTACACTCCAATTCGAGCTGTGGCGGNTGTGGTGTTTTAA ATAAATCAATGGACTTCTTCGGATTGGATGACTGTTGGTCATTTGGGNCTTCCAAATACAATACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415696: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156961122639H98418SMNHADA016079T3SmAW


Date: 6:10:51 on Wed 22 Nov 117.