EST 415700 is a singleton


Sequence

>415700 (1 EST) Length=215 TAATTCCCAAGTTTGAGGAAAAGAAATTGTTCCCCTGAGTTACAGCAGTTCTTNTNGGTCTTATCTNTTACAAGGTACAA AAATCAAGGAAATCTCCAAGTAGACGTAAGACGTATACCATCAGAGTACATTGTCGTGAACTGATCTAGTTGCTGGTTGC TCTACAGATCGACATGATCTAGATAGCAGACAGAGACTAGTTCAAGGGACTGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415700: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157001122643H98422KJ4SLB109T3JHU93SL-BmL4 (JHU)


Date: 18:44:39 on Sat 18 Nov 117.