EST 415703 is a singleton


Sequence

>415703 (1 EST) Length=212 AGCTACTTAAAAAGTGTGGATTCGGAAAACATGCCATATTTACGATCTGAGTACAACATAGACCGCGAATAGAACGTTTC AGTTGCTTTCCGTTAAGGCAGGCAATGCAACATGTGGATCGCAAAGGCACTATGGTAAACCGGAAGCTAGTCTATCAGTC GTGTGATGTGACAGCCGAGTGCTATCATAGATGTAGATACTAGGTCAGTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157031122646H98425KJ4SLB112T3JHU93SL-BmL4 (JHU)


Date: 13:20:29 on Wed 22 Nov 117.