EST 415705 is a singleton


Sequence

>415705 (1 EST) Length=250 GTTTGGGTTTATGGGCNNNNCTGTTGGCGNNGTAGGCAGGCCNTGGTCNNNNTCCCGGCTTGGTTCGGTCTTTTATGTTA ATCAGCTCAGTAGTTCGCAGGTTAGCAAACGTTCACAGCGAAATCAGCTATCGAGAGTACAGCCTGCTAAAGTTGGATGG GTTCTATACAGATGATGCCAGTGTATGTTGGTTAGCTGAGTTCTATACGTTCAAGGCGCTACTGATACGGTCCATAGACA GCAGTCGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415705: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157051122648H98427KJ4SLB121T3JHU93SL-BmL4 (JHU)


Date: 0:33:43 on Thu 23 Nov 117.