EST 415709 is a singleton


Sequence

>415709 (1 EST) Length=196 TAATTACCCAAGTTTGAGGGGAAGAAGGNGAAATCTGGAANATCATCAAAGACTGATTGTATGCCAACAAAAAATCGGAA GCTATGTATACAGGATTGTTCAAAGCAAGGCGCTATGATGTAAGCTAAGAAGGATATATTAAAGCACACCATGATCATAC CAGAATGTAGCAGAGTTAGAGTATCAAGCCTCAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 415709: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157091122652H98431KJ4SLB126T3JHU93SL-BmL4 (JHU)


Date: 10:49:58 on Tue 21 Nov 117.