EST 415716 is a singleton


Sequence

>415716 (1 EST) Length=208 AGTTTTAAGAAAATTAATTATTTATTTAGACTCTTTAAACCAAGNNNTCCTCACCTTCTCATATTCAGCATACTTCCCTA TAGCAAATTTACTTTGGTCTTCCTTTATTATTAACCAAAGATGTAAATAATCCACAGAGAAATCTCAGAATGCATCTTAT GTGAACATATTCGAACAGTCAGTACACTCTNTAAGTATCTATTCACGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 415716: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157161122659H98438KJ4SLB135T3JHU93SL-BmL4 (JHU)


Date: 6:54:34 on Tue 21 Nov 117.