EST 415721 is a singleton


Sequence

>415721 (1 EST) Length=211 AGAATGGTGAATAATAGTAAACGGATCCAGGTAGTGCGGGGATAACATGCAACCACGGAGATTATTTAAGTTTGTATCAA TACAAAGAAGAGCCGTTGCAAGGTGACTTGATGATTCTTATCGATAACTATACGAATTGAGTTTTACCATCTGAATCCTA TAATAAGGAGCACAAGATTCATGATCAGCAGCTCAGAAGAGCTGAGAGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415721: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157211122664H98443KJ4SLB140T3JHU93SL-BmL4 (JHU)


Date: 16:11:29 on Tue 21 Nov 117.