EST 415727 is a singleton


Sequence

>415727 (1 EST) Length=238 TTACCCAAGTTTAGTTCTGGAACTGAATTGCAAAAATTACTTCTGCCGAAGGATTTCCGGATGGACCNGAAGGCAAAAAC CAAAAGTAAGCCCGGAAGTAATCAGCAGAAAATGGAAACACATATGAGAGAGACGAATTTGAAGAATTTCCCACCAGATG GCAGCAAGGCGGGCGCTGAAGATAAGAGGAATAAAGTTATGAGAGCTGGATATAGCTAGAGAGTATGTCGAGTAAGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 415727: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157271122670H98449KJ4SLB150T3JHU93SL-BmL4 (JHU)


Date: 15:0:50 on Fri 24 Nov 117.