EST 415729 is a singleton


Sequence

>415729 (1 EST) Length=257 GAAATAGCATATAGATGTAGATGTCTTAACCAAGTGATCTGAGACTGCNNGCTCGACTTCTATGGATCGTGATACACTGT CCCGTATAGCAGAATTTGACCTGATTGGTCTGACTTTATCTGTTGTGAATAGCGATGACCAATGCNACATAGCAGACTAA ACAAGCAGTGGCAGCGGCGTGTAGGCTCAAACTTGGTTATATCGCTAATATCGACCTCTCGAGGAAGTAATCGAAATACG CTGTAGCAGACAGGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415729: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157291122672H98451KJ4SLB152T3JHU93SL-BmL4 (JHU)


Date: 19:4:28 on Sun 19 Nov 117.