EST 415730 is a singleton


Sequence

>415730 (1 EST) Length=151 GGCGGATCGCTGGTGGCGTGAGGGTGCTATTATTTGTTTTTATTTGGGTCTCGGTTGGTGCTGTTAGTGAATTGTGCCGA TCACGCTGGCGATAATCGTGTTCTGATTCGTGTGTGGATAGGGCGCTTGATCGATTCGGCGCGTGTGTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415730: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157301122673H98452KJ4SLB153T3JHU93SL-BmL4 (JHU)


Date: 8:25:16 on Wed 22 Nov 117.