EST 415732 is a singleton


Sequence

>415732 (1 EST) Length=168 AATTCCATTCCTAGAAAATATTAAATGGTTTCAAACTCCTGTTAGGAAGCACATAGTAAGTCTAAATCGAACTAGCGACT TTTGACACGCAGAAAGACGAAGTCATAACTAAAGTCATCCTCTCTTCATCGATTTTACTCTCGTTCACCGATTTGCCATA GACGCAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 415732: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157321122675H98454KJ4SLB155T3JHU93SL-BmL4 (JHU)


Date: 23:46:40 on Sat 18 Nov 117.