EST 417963 is a singleton


Sequence

>417963 (1 EST) Length=287 TAGCNCGGCACGAGGAAGTTCGTAAACGTAGACTAGAACTTTTTGGATGCTCATCTGGAGAAATCACTTCAAAGTCTAAC TCTGAACCTAATGATGTGTCCAATTGATCTTGTGACGTTTATATATACCTAACTCTGATATTGCTCGGTTTATTCCGAGT TTAGTTTGTGTAAGTTGAATTCTATATGGCCATATATTCTTTCAGAATTCTGGAATAAAACGAATGGCCTTCTATATATT TCAAAATTGAAATTATATTTGATGTAACATTTTTTCGTTATATTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 417963: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179631125852N20680SMNHADA001002SKSmAW


Date: 21:22:26 on Sun 19 Nov 117.