EST 417976 is a singleton


Sequence

>417976 (1 EST) Length=480 CCCCGCCCTCGAGGGAGCTANNTGGTTTAGNAACCACGACANTCACTTCTAAATGAAGACTTAGAAGATTTACAATATGT TGAGGAGCTGGACACCTTATATCATATTGANGAGAGTTATNAGTCTAAGGATAAAGAAAANTATAGGAGACGAGATTATG GAAAAGACCACCATCATCGACGTAGGACATCGGGAAGANTCTCCTCATGCTGAACGTAGAGAAAGAGATAGAGACCATNT ATCATCAAGACATAACGATCGTGAAGACAATGAACGCAAACACGATCGTGATAAAGCTCATAGACGTAGTCATTCTGGAG GATCGTCGAAATGCTCGATCCAAACGNGATGATAGTCGTTCGNCAGATCATAAACGTACTCGAGATAANGTCGTGAANCG ACGACATTAATTGTTGAGTAGGCTGATCNATTGNTTATACTATGTTAAATAAATACTTGGTGGGATTANAAAAANCAANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 417976: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179761125865N20693SMNHADA001040SKSmAW


Date: 17:16:41 on Wed 22 Nov 117.