EST 417977 is a singleton


Sequence

>417977 (1 EST) Length=378 CGATAGTGAATGGACATAGGCATTTGATTCNAGAAAATAAGCCTCATTCTGATTCAGATCATGGNAAAGATAATTCTCAA TCTTTANTAGTTCGATCATCAGGTGAATTAATTGATTTCAGCCAATGGAATTTAANCTCTCGTCGAACATGGTATGGTTT AGATCCGAAAATTGGTCAAACACCTATAGCACAAATAAAAGATGGTCGTACTGGTTTACCAATACAGTATACAGATGAAA AGAACGTACTATCATCCGANTAATGATTATTATTATACGCTTTGGATCCTCTGATCCGTGGACAGNTTGGACTTNGTACA TAAATTTTCGTGATATTGGNATGTTTGCCATGTTGAGATGATTTACTAAAATNTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 417977: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179771125866N20694SMNHADA001043SKSmAW


Date: 12:44:23 on Tue 21 Nov 117.