EST 417981 is a singleton


Sequence

>417981 (1 EST) Length=207 TGTGNNGGAAATTCATATGAGCACTATGGTGGANTAGCTTATCAGTTTCCCTCGATTTCCCTTTCTCCTCTTTCTTCAGN TTTNAAAAATGACAAAAAATGTACCTTAAGCTACTGTTAGTGTTTGGCAGTATTGTTGTCTGTTCTTTGAAATATATTTC TACACATGTATACCGGTAAATCGATTANCTTCCTTATTTCTCAGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 417981: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179811125870N20698SMNHADA001052SKSmAW


Date: 12:43:37 on Sat 18 Nov 117.