EST 417982 is a singleton


Sequence

>417982 (1 EST) Length=357 GACGAGCAGCTGAATTGTATNGTTATTCTNGTACAAGTGCTCAGTCAGGTTGTGGTGATCCAATTGGATGTAAGATTAAT TCATTGGAAGNAAATGTTCTGGTCGAACATTAATTGAAAATTATTGTGTAAAATTAATTGAAAAAGTTCANGATCAAACT ACTGTAACTCGTGGTTGTTTAAGTGACCTAATAATGAATACACAATATCGTTTAGATATGCCACAACTTCGTCGTCATGG TTATTGTGTTACTNCTCGTGATTATCAACATTATTTATTAGGAGTTCTAAAAGGGAAAACTTTAGTTGGAAACTGCTATG GGATTATTTAGTGATGAAAATATGGATTTNAAACGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 417982: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179821125871N20699SMNHADA002001SKSmAW


Date: 23:39:3 on Sat 18 Nov 117.