EST 417983 is a singleton


Sequence

>417983 (1 EST) Length=177 CCCACGANCTGAGATTTTGCTTCCAGATTGATTTTNGTACTGGTCGATCTATTATCATATTGTGGNCAGTGTGTGCTTTT GTGTGTGGTAATTTTATCTGTGGTAATTTTATATAATCGAAAGTGAGACATCTTCATTATTGAGAAACAATTCAAATAAA CTGTTATTCGAACAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 417983: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179831125872N20700SMNHADA002002SKSmAW


Date: 2:4:50 on Wed 22 Nov 117.