EST 417986 is a singleton


Sequence

>417986 (1 EST) Length=412 CTTCTAGTTGTGGATTCCAAAGTAAGGTTGACAGNTTTGGATTCATTGAGTCATGTATTCTTCCTACAACAACCCATAGT TGGCAAGACAGTCTTCAATGCTAGACAGAAATTTAAGACTGGTATGTNGGCTGTCAGTTTTATATTTTATCTACGACGTT TAAAAATGAACGCTGCCTATTTAAATATCAATCAATTATCTATGGATCCATATTCAAATAAGAAATTACGTAAAATTATT GATACACTTGCCTATGATGTTTATAGTCAATGGGTTAAAAAAGGTGAAGAACAAAATCGNGCTGAATTATNTGGAAAATA TNCCACGTCGGGGATATGATTGGATACANCAGATGGATTATTTCATAATAGTCCAAAACGTCCATTATTAACCGATGGAT TCTATAAATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 417986: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179861125875N20703SMNHADA002007SKSmAW


Date: 2:31:0 on Thu 23 Nov 117.