EST 417987 is a singleton


Sequence

>417987 (1 EST) Length=276 ATTTTTATTGTTTCTCTATATTTAAAATAGGTGCACCATATAGTGNAACATAGTAGTTTTCTGGAGTTAAAACAATTCAT TACACGTCTTCATCCTGTACAAGTACAACCTACTGTTTNTGGTAAATCGATCACTGTGACGAAAGATACAGTACATAGCT GGTTGAAATGAAAAAACAAACGCCACTGTCATGGAAAGACCAGTAGTTTAACTGGGATAACGTATTTGTACAGAAATACT TTTCTTGAGTCTGCTAAATAAAATATTGATTTATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 417987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179871125876N20704SMNHADA002008SKSmAW


Date: 13:51:33 on Mon 20 Nov 117.