EST 417988 is a singleton


Sequence

>417988 (1 EST) Length=232 CACGAGAAAATGNCACGAATAGTCATGGNAGATTCCGGATAATTAAGTGGCACAAATTGGATCAAAATTTCTTCATACTC TTTGGTGTAGTACTATGTNGTACTTAGGATTTATTGCTCCCCTTTTTCTTCTAACAGTGATTAACTCCTGATGTATGTTT TATACAGCAGATAGAAGTATATGCATCATTTAATGTACTGTAATAAAGCAAAGTAAAAAGATTTTACAGNTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 417988: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179881125877N20705SMNHADA002010SKSmAW


Date: 4:15:25 on Fri 24 Nov 117.