EST 417989 is a singleton


Sequence

>417989 (1 EST) Length=302 GGAGTTGGTTTTNCTCCTCATAAATATATCGNAATGGAGNAAAGTGATTATTTACATCTCCGGGTGATAAATCCATCAAC ACTGNCGTTTACATATCGCTTANGTCCTGGTCAAATAGGACCTCATTTTANTACAACATTTACATCTACCTCATTAGTGN TAACAGAACCTCCTCACGCATGTGAGCTGATAAATAATGCATATGANGTTAATCGAAATATTGNTCTCATAATTCGTGGA GGTTGCAGTCTCGTCACGAAAGCTATTAATGCTCACGTCGCCGGTGCAGTTGCTGTGATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 417989: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179891125878N20706SMNHADA002021SKSmAW


Date: 16:13:35 on Tue 21 Nov 117.