EST 417992 is a singleton


Sequence

>417992 (1 EST) Length=384 AGCTATGTGAAGGATCAGACAAGTCAGAGGCTGTTGTTGCTATTGAGTCCTTGCTCACTTCATGAATGTTCCGATGTACA ACGCCAAGGTCTTCATGATGTAATGAATGCAGCATAGAACGTATGTGGAAAGAGGGAGTTAGCAATCTCTCCGTTATATC AGCTTGTGAATTATTCCAGCGTTTATTACGCTAGCAACACTGGATAAGTCGATTTTGATGAGTGTAAAGAGTCTTTTGAA GAGCCAGATATTTANAGAAGGCGGTCANGTGGCGAAAATGNAGAACTCCTGAATAACCCTAATGTCAGGATTCTGNATCT ATCCGGTGTCTGTGATGATTGTGANTCCAAAGGCTCATGTATTAAACNTCACTGCGGTGGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 417992: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179921125881N20709SMNHADA002025SKSmAW


Date: 16:13:33 on Sat 18 Nov 117.