EST 417994 is a singleton


Sequence

>417994 (1 EST) Length=336 CGACAGGACTATACTGCATNTGGCANGTGGATATAATTTCCATTTTTTCACTGGCTACCAAACGAAATATTAGACTTGNC AAGATAAACGATACTCTGCAACTTCAGCTGATCCATCCAAATACTATCTTGTTCATGGTATTTTTTTGTCGAGACTAATT ATTCACTAAGCATATTATATTATATTGCAAATCGGAGCTCATATTCTTCTCAAATGTTATTTACAACTCTTCATGCAAAT AGTANTATCCTTCTCTAANTCCCCCAGNCTCAGAACCTACTTCATTNTTATTGGACATTTNGAGGATATGTACCAGATAT TNTTTGTTNTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 417994: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179941125883N20711SMNHADA002027SKSmAW


Date: 17:44:25 on Mon 20 Nov 117.