EST 417996 is a singleton


Sequence

>417996 (1 EST) Length=380 GAACTACGAGATGTTCAGAAGAGAAGTAGGATGTTCATTTATCACTTAAAACAGNTGCTGGATGTTATTTATTACGGACA AAATATATGCATGAGTTTACAGAATTTGTTCCGAACAGTGATATGGATCCAAATATTTNGATGCCTATATAATCAGTCTT AGCAGAGCTCAAGAATCACTGTGCCAGAGCAATTGAATTAAACATAAACCACATTTACTCGCTGGTNTGCAATGAAACTG CTAAGTTTACGAAAATCTGGTTTGGTTACACAATGTAATCCTAAAATGTGGAAATNGAANATATCAGAATTAACAGGGTN GTACGATCCATGATTGTTATATGGAGATTATGGAAACGGAGGAGTCAGTGTGAATCTAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 417996: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179961125885N20713SMNHADA002030SKSmAW


Date: 9:47:16 on Fri 24 Nov 117.