EST 417997 is a singleton


Sequence

>417997 (1 EST) Length=167 GCTCGGCAACATGCTTGATTACAACGTATCGGGATAAAATCGGTGGCTTCTGCTATAGAAAAATTATTAGTGTTTAAATA TCANGTTGTGATGTTATTGCTTACANTCCAATTATACTTACATAGTTCTGTAATTTCTATTATACGGTATTATCTGTGTT TACGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 417997: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179971125886N20714SMNHADA002032SKSmAW


Date: 6:8:48 on Wed 22 Nov 117.