EST 418006 is a singleton


Sequence

>418006 (1 EST) Length=312 ACATCACANTGAAACANTCGAGAAGNCANCCACAAAAATGNAGTTAGAAACCTATTATTGTTATCAATGGGNTNATTGTG TTTNTNATTAGTCTNCATCCATAGNTCCTGGTTGANGAGGTNTCGGTCCACCAGCTGGGCGTGCCATAATAATCTGAAAA GTTTCCCGAAACAACAAGTGAGTTAGAAANCAGGCATGANGAGAGAGAGAATAATCTTTGGGAAATCTAAAATCAGATAT ACGTCAACTAATAGTGGTCTAATAACCATTACAGAATGTNCCACACTACCCGCAAGAATAATCGAGGAGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418006: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180061125895N20723SMNHADA007009SKSmAW


Date: 21:41:43 on Mon 20 Nov 117.