EST 418009 is a singleton


Sequence

>418009 (1 EST) Length=290 ATGGATTTGGCAGATTTAAATCTTATAAAAATAGCCTTCAATCAGATTTACACATTCAACCGTTGACTTTCCAACAGTTC AGACATGGAACAGATGTTCANTTTGAATATTGTCCATCCCTTCAATGTTGGNCTCTTTATTCAGTCGTGAATGACTTATT ACCAGTAACTAATGGATGCCCTGTTGGGTATGATAATGAAACAACAAGCAAAAATTTAATAAAATTACCCAATANTAAAG TTACAAATAATCTTTTACAGNCGGCTAGATCGAACTGTGAACAGAATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418009: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180091125898N20726SMNHADA007021SKSmAW


Date: 18:55:2 on Sat 18 Nov 117.