EST 418010 is a singleton


Sequence

>418010 (1 EST) Length=240 AAGAACACCANNNCACTATTATCCCGGTTTTATTGACCCTTATTGACTTNGTTTATGTTTACGCAAGTGTATGAGTGCGT GCGTGCATGTATTCTTATTTCATTCATGCTTATTACATATTACATTAGTAAGTAAGTNGTTGAGTAAACCATTTGGCATT ATCCTTATGGTTTACTCTTCACATGACAATGTGGTTATAATGAAGAGAAGAGAAGAGAAATTCACAACCACACACACACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 418010: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180101125899N20727SMNHADA007023SKSmAW


Date: 14:29:37 on Fri 17 Nov 117.