EST 418019 is a singleton


Sequence

>418019 (1 EST) Length=320 AATGTTTCACTTACCTCTTGTTTCCACTTCTTTGTTTTNNGATGGTACAGCCAACCGTAGTCAAATTCTTGCTCGCTATT TCATGCCTTTCCATGCTCCTCTCCTCTTCGNCTCTTTTATTATTGCAACAGTTCCGCTTTTACCTTGTTTTCCTCTTCAT CTGATCATATGTGTGTTTCCTGCATTACCTACCCCTCAACGCAAGTATTTGTGTTNGTATCAGTTTNATGTCTATTCGAT TGTTGTGTTGGTTTTGGTATTACCTTTCAATATCCTATTTTTATTCAATCAATGAATCATATGAATTTGGAGGATGGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 418019: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180191125908N20736SMNHADA007056SKSmAW


Date: 22:29:43 on Thu 23 Nov 117.