EST 418022 is a singleton


Sequence

>418022 (1 EST) Length=313 TAATCAATCACAAAATATAATAACAAATAATAGAAATCAATCAGATACAATTAATTTANATCTTTTAAGATTATTACATG ATACTGATGTAGAATCAAAAGCAAATGCTATGGCAACCAATAGTAATGATTCAGCATTAGTTCAACTTGTTCTACTTATT ACACAAACTGTAGCTGCATCCTATCCAATCAGTTCATCTGATTCTACATCGTNGAATAATTCCAATGTAATGACTGGATT NGGTATAGGAGGAGGAGGAGGAGGAAATGTTAACAGTGGAGCTGGTATNGGATCACAACAAGTATTGTATGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 418022: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180221125911N20739SMNHADA007062SKSmAW


Date: 19:26:25 on Fri 24 Nov 117.