EST 418023 is a singleton


Sequence

>418023 (1 EST) Length=120 CATNCACAGNCACGTTTGGNTAAATCTGGTACACATGTTATGTCCTATTTTATGGTACGATGTGGTCAGTTTGATTGGTA TATAAACTCAGTATGTTTGAAATATAATGATTCATACCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 418023: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180231125912N20740SMNHADA007063SKSmAW


Date: 14:49:43 on Sun 19 Nov 117.