EST 418025 is a singleton


Sequence

>418025 (1 EST) Length=174 ACCAAAAATCTTCTTATTTAAATTGAATTAAANTAAATACAAATGAAGGCAAAAANTACCAGCAGGAAATACAAAACATA CTAAGCACTACTTTAAACGAAATTTTCGAAAGATATTGTGATTAAAATTCCCTTATGATTTGGATTAAACAAATAAACTA TCTTCCTTTATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418025: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180251125914N20742SMNHADA007067SKSmAW


Date: 4:12:11 on Wed 22 Nov 117.