EST 418029 is a singleton


Sequence

>418029 (1 EST) Length=350 GAAAGACCTTTTACGAACTCGCCTGAGTGAATGCGGNTGGAGCGAAGAACTAAAAAGCCATTGNCGAGATGTTATTCGAG AACGCGGGATTGAAAATCTAACGGTAGATGATTTGGNAGCTGAAATTACCCAGTCGGTCGACGTATGGTACCAGACACAG TAAAGCAAGAGCTACTGGATGAAATCCGAAGTGTTTGAGCAAAGAAACAGATATACTTTGACCGTTAGGCAAATCGTATC TCGTAATCTTTGAGTTTCATTCCTAGTATTCAATCTACGGTNGTGTCGGTATTCTGGATTCTATTTTCTCGCTAACCCCT GTCTTTATTAGTCTATCAGTTGGTCTTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418029: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180291125918N20746SMNHADA007087SKSmAW


Date: 12:41:22 on Sat 18 Nov 117.