EST 418030 is a singleton


Sequence

>418030 (1 EST) Length=220 ATCATTCNTCCTGNCTTCAGTTGATCCATNACTGNAAATATGAAACAGAAAATAACATTCTACTGCCAGCTCATTCTGTG ATCAACGGTAATTTAATATAATGTTCTCTATTGATTAAAATAAGTTTGTGGTATACTTCCAGCGTCGTACATNATTTGTT ACCATCTNGANCTGAAAAATTTATGANAGTCTAACTGTATCGTCATTAATATNATCTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418030: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180301125919N20747SMNHADA007088SKSmAW


Date: 17:2:23 on Thu 18 Jan 118.