EST 418031 is a singleton


Sequence

>418031 (1 EST) Length=130 ANAANTTGGNGAATTTCTGAATATGGAAGATTATGTGGAGAAACAATTTACAATTGGACGATAAACTGTGCTTCATATTA ACTAACAACAACTGTACAGTTTTTGGCATTATAAATCTGGTTAGTATGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418031: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180311125920N20748SMNHADA007090SKSmAW


Date: 14:33:3 on Fri 17 Nov 117.