EST 418032 is a singleton


Sequence

>418032 (1 EST) Length=200 TATTTATTTTCGTTCTTATTCGNTGTNGTCTCCTCTATTTTTGGACTTTTTCAATATTTTGGGTTGGTTTTATTGGTGTG TTTCTTTTTAAAAAAGAGTAACTGTCTGCGCACATTTTGGTGGTGTTCGTTTTTTCCTCCGCGGGCAGTTGGAAAAATGT TAGTCATTTTTTATGTGAGTGTGTGGATACTTGTGTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 418032: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180321125921N20749SMNHADA007094SKSmAW


Date: 14:8:44 on Fri 17 Nov 117.