EST 418034 is a singleton


Sequence

>418034 (1 EST) Length=440 AGTTGAGCGCATCATTGGCTTTACACGTCAGCTATGGAATTAACTTTTGTTGTCATATTTTGTTTATGTATTGNAACTTT CACAAGGNNATTTTCTTTCATATGAAAGAAACCGAAGAACGGTGCTTCTTGGAGGATGTTCCGGAGGGACACTCTAGTGG CAGGTATACATATTTCTGGGAAATAATTCTCTCTCACAGGGGAATTATAAATTATTGGCTTCTAAAGGAAAACATTTTGG AACGNCTCCAAAGACTTGGGAGTCAAAGTTAAGGTTATTGATCCATATGACCAAATTTTGCTCGATCGTGTGTATTCTTC AGAAGGGCGGNTTGGTTTTTACTGCTCATAGGACCTGGGCGGAATACAAAATATGCATTTCATCTGATTCCCGGTGGCTT GGTTTGGGNGGGATCACAATTGGAGAGTACACCTCGACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 418034: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180341125923N20751SMNHADA008001SKSmAW


Date: 16:22:28 on Mon 20 Nov 117.