EST 418036 is a singleton


Sequence

>418036 (1 EST) Length=370 TTGGAAAGTGTCCTTGATGGATTAGTGGGTCAATCTATGGTTGTCGCATTATCTCCAACGCCAGATGATCAAAAATTGCA ATTGGAAAACTCAATAAAGATTATTCAAAGTTATTTTGGNAAAAGTACATGACATTCTAGAGCTTTATCCTGAACGAGAA TGTGTATGGATGTTTCGAAGNACGATTGATTACATTCTGGATCCAATTAAATCAATACCAATCTTCATACAATTCCAATG AAGGCATTGTAANATTACTTAGGNCCAGTGGGAACCTNTACTTCCTAAANCATTAGGATATTATTACAAAATTAGGAATC ATCTAAGATCTATTCTACAGGGATTTTCTNTCAAATGGAATTTCTTAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418036: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180361125925N20753SMNHADA008009SKSmAW


Date: 2:44:21 on Fri 24 Nov 117.