EST 418037 is a singleton


Sequence

>418037 (1 EST) Length=200 AATATCNAAAAATTATAAAAAAAAAGAGGAAGACTATGATAATAAAACNTATTCNATTAAATTTAATTCAAAAAATTAAA AAAAATTCGGATAAATTCCTTCTCTATGATTATTATTTTCTTTGCTTATTTATTATGTTCGATATTTTAACTAATACTTC NTAGTACGCGTTACCATGGAAACAACAGTGGAAGGATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 418037: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180371125926N20754SMNHADA008010SKSmAW


Date: 8:14:43 on Wed 22 Nov 117.